The criminal WHO blows its own cover: fake PCR test

by Jon Rappoport

December 31, 2020

(To join our email list, click here.)

In early 2020, the WHO accepted a PCR test for “SARS-CoV-2” that was designed without having possession of the virus. Yet the test is meant to detect…the missing virus. This is evidence of deep criminal intent. [1]

But as of December 14, 2020, WHO has made a correction [2]. Thereby blowing its own cover. Why?

Two reasons. Huge numbers of people have caught on to the PCR test scam. And by their correction, WHO paves the way for “declining COVID case numbers”—thereby making it appear the new vaccine is a roaring success. I predicted this development. [3] [4]

A brief review. The PCR test (a complete fraud for several reasons) is run in “cycles.” Each cycle is a giant magnification of a tiny portion of the swab sample taken from the patient.

As I’ve reported, even Tony Fauci readily asserts that if the PCR is run at 35 cycles or higher, it’s meaningless. [5] [6]

Every positive result—indicating “infection with the virus”—occurring at 35 cycles or higher is meaningless.

BUT, as I’ve also pointed out, public health agencies recommend running the PCR test at up to 40 cycles. Therefore, labs comply.

Therefore, millions upon millions of PCR tests results, over the last nine months, which indicate “infection,” are a vast lie.

Therefore, the COVID case numbers are a vast lie, and the lockdowns, which are based on those numbers, are absurd, insane, criminal, and predatory.

NOW, the WHO is walking back their stance on how the PCR should be run, for the reasons I mentioned above.

The WHO document is titled, “WHO Information Notice for IVD Users/Nucleic acid testing (NAT) technologies that use real-time polymerase chain reaction (RT-PCR) for detection of SARS-CoV-2.” [2]

Here are the money quotes. The language is mealy-mouthed, intentionally confusing, cautious, and sterile. Nevertheless, we can see the intent to lower the number of test cycles.

“Users of RT-PCR reagents should read the IFU [Information for Use] carefully to determine if manual adjustment of the PCR positivity threshold is necessary to account for any background noise which may lead to a specimen with a high cycle threshold (Ct) value result being interpreted as a positive result.”

Translation: Using too many test cycles—aka “high cycle threshold (Ct) value”—has resulted in patients being told they’re infected, which is a lie.

“In some cases, the IFU will state that the cut-off should be manually adjusted to ensure that specimens with high Ct values are not incorrectly assigned SARS-CoV-2 detected due to background noise.”

Translation: Running the test with a high number of cycles yields “background noise”—aka a false positive result. The patient is told he’s infected but he’s not.

“The design principle of RT-PCR means that for patients with high levels of circulating virus (viral load), relatively few cycles will be needed to detect virus and so the Ct value will be low. Conversely, when specimens return a high Ct value, it means that many cycles were required to detect virus. In some circumstances, the distinction between background noise and actual presence of the target virus is difficult to ascertain.”

Translation: When the test is run with a high number of cycles, we can’t tell the difference between “irrelevant” and “meaningful.”

A frank and honest translation of the WHO message: “We’re changing the way we’re doing PCR tests. We were running them with a high number of cycles and getting millions of false positives, and those numbers were deployed to justify the lockdowns—but NOW we’re moving to a lower number of cycles. This change, all on its own, will result in fewer positive results, fewer case numbers, making the vaccine look VERY GOOD.”

The WHO is still crazy, still criminal, but not entirely stupid. They know what they’re doing and why.


SOURCES:

[1] https://blog.nomorefakenews.com/2020/12/25/you-thought-the-pcr-test-detects-an-actual-virus-wrong/

[2] https://www.who.int/news/item/14-12-2020-who-information-notice-for-ivd-users

[3] https://blog.nomorefakenews.com/2020/09/22/how-cdc-will-fake-effects-of-covid-vaccine-make-it-look-like-success/

[4] https://blog.nomorefakenews.com/2020/11/13/how-theyll-fake-the-success-of-the-covid-vaccine/

[5] https://blog.nomorefakenews.com/2020/12/03/lockdowns-are-based-on-fraud-open-letter-to-people-who-want-freedom/

[6] https://blog.nomorefakenews.com/2020/12/08/florida-forces-labs-to-report-number-of-pcr-test-cycles/


The Matrix Revealed

(To read about Jon’s mega-collection, The Matrix Revealed, click here.)


Jon Rappoport

The author of three explosive collections, THE MATRIX REVEALED, EXIT FROM THE MATRIX, and POWER OUTSIDE THE MATRIX, Jon was a candidate for a US Congressional seat in the 29th District of California. He maintains a consulting practice for private clients, the purpose of which is the expansion of personal creative power. Nominated for a Pulitzer Prize, he has worked as an investigative reporter for 30 years, writing articles on politics, medicine, and health for CBS Healthwatch, LA Weekly, Spin Magazine, Stern, and other newspapers and magazines in the US and Europe. Jon has delivered lectures and seminars on global politics, health, logic, and creative power to audiences around the world. You can sign up for his free NoMoreFakeNews emails here or his free OutsideTheRealityMachine emails here.

75 comments on “The criminal WHO blows its own cover: fake PCR test

  1. george says:

    Humanity is infected with a deadly parasite. it will end by killing it. The fight was lost 75 years ago.

    • Elo Himmler says:

      I know (((who))) these parasites that you happen to be talking about are, and I agree. Though, it will be a difficult endeavor to mobilize others who feel the same. Especially since our media and judicial system are the institutions that are most infected with this disease.

  2. THX1138 says:

    Every government institution has shown themselves to be criminals. Every single one.

  3. John Smith says:

    where is all the DNA from these swabs going?

    • Rick Potvin in Phoenix AZ says:

      where “ARE” all the swabs going. Plural.

      • oranje says:

        “all the DNA” is singular so John is correct.

        He did NOT write ‘where IS all the swabs going’.

        He could have written

        ‘Where ARE all the DNA samples from these swabs going?’

        but he didn’t. Anyway it is a good question.

        Are the data all going into the’trace and track’

        software data base?

      • NC says:

        Sorry Rick, the plural of”to be”was thrown out over the past few decades in American English. “Here are” became “Here’s” and now they don’t even abbreviate. Maybe people are realizing that all is really one thing? Spiritual masters and Quantum physicists know this to be true.

      • Jim S Smith says:

        English Grammar is no longer taught to be properly spoken or written. Because of all of the SJW’s in the teaching profession, proper “English Grammar” is considered “racist”.

        Noticed several others have ignored this problem.

        Just imagine, interpersonal communication is really going to become lots of fun, once more of these “multi-pronoun” morons get elevated into high places in society.

    • Madness says:

      Yesterday there was a link here to a video of a very clever lady. “Catherine Austin Fitts | Full Interview | Planet Lockdown” – one of the best summary of the situation.
      She told that with their present knowledge the elite can live as long as 150 years – but we shouldn’t as it would be very visible otherwise they live very differently.

      To live such a long life an organ always can be handy. With that amount of PCR they have an unlimited organ-donor database. Sounds unbelievable?
      Here in the UK they changed the donor-law around spring, it was the most important thing during the middle of the “pandemic”. Till then you were a donor only if you offered it. Now you are a donor by default, you have to opt.out but as many were not aware of the change they couldn’t opt. out. While opting out it turned out we had to notify about it our close relatives or friends in the case of the NHS would forget about that we opted out.

      We are human guinea pigs to them. If they want to make more experiments with transhumanism some body and organs with mapped DNA also can be very handy to them. If people would think that the evil, Satanist cabal elite are not capable to do such thing, think again.

      Don’t let yourself being tested, just don’t.

      • Lyn P says:

        The UK organ donor situation is very symbolic of all the globalist evil. Very CCP.

        Catharine Austin Fitts is so unbelievably insightful on all matters “covid” that it borders on frightening! Yet she lays things out intelligently and matter-of-fact like.

    • Nicorio says:

      chez les gates via le health data hub

  4. Thom Madden says:

    STOP THE COVID-19 QUAXINES IMMEDIATELY!!! WILD COVID-19 HAS NOW BEEN PROVEN IN-VIVO TO ABOLISH GLOBAL INFLUENZA AND WITH IT THE NEED FOR THE SUPER DEADLY, MAIMING ATROCITY FLU-JAB… Abolish Face Masks & Lockdowns and All Humanity Comingulate To Your Heart’s Content this Wondrous EVE Of THE GREAT AWAKENING!

  5. Paul says:

    I like the “Translation:” portions.
    Gets right to it.

  6. DL says:

    It is now seeming to me that the lie is getting soooooo big, lie on top of lie after lie, etc. that this will all fall back on itself in one big backfire!

  7. Wanda says:

    I actually forwarded the WHO link to Dr. Scott Atlas (remember him?) on December 17. I wrote…

    “Here you go Dr. Atlas, I’ll dissiminate this to you
    https://www.who.int/news/item/14-12-2020-who-information-notice-for-ivd-users

    Will this lead to some change in cases?”

    He did not reply to that email, but I am hopeful he read it. He actually replied to me once before when I questioned if Trump’s coronavirus test had been cultured. I was shocked to get his reply. I think Dr. Atlas is aware of all this, but unfortunately he has been villified thanks to the corrupt media. When we find pertinent information, we need to email, call, write, etc. people whom we think are on our side. We must always hope that what we do individually may lead to progress!

  8. Sean says:

    I was also thinking they could be using lower cycles already, perhaps on specific individuals and groups, to project and control other disinformation.

    I went to a new foot doctor yesterday for my foot injury. Thanks to other readers on this blog, I no longer allow laser temp reading on my head. The nurse said it a requirement as she pulled her gun out to shoot me as I totally surprised her by blocking it with my hand and asking, I hope you have some other way. She ran out and I was abandoned for some time. Finally another nurse came in and asked if it was ok to do it on my wrist. I said sure. And then they said I had to wear a mask. I said I didnt bring one, so they got me one.

    Doc came in. Check my foot and I asked how long he plans to go along with the whole mask thing and when professionals like himself will take a stand, since he already told me he knows its bs. Short of it he said that the governor of texas could be sued if he didnt do the medical tyranny. I didnt have much of a response to that other than, well thats how leadership is, you do your best decision making knowing it affects others regardless which way you choose. So I can he is protecting it that way. I express that that was kind of a weak stance and left it at that. Im going back to SD or Florida. Yehaw.

    • Marilyn Shepherd says:

      I would never pass a temperature check., I have Crohn’s disease and after a bit of a stuff up from major surgery my internal temperature sits on 38 instead 37 yet I don’t have a fever.

    • Tim_2A says:

      Uh-oh. Turn your head, and stomp!

      Did they make you wear a mask on your (probably bare) foot?

      Bear with me, but imagine the (“Idiocracy” style) headlines: “Patient’s Foot Tests Positive*, Coca Cola Blamed, ‘Doctors For “Brawndo”‘ Say”

      Reading a little further in the article, we find the startling revelations: “Man denies even knowing any Austrians, yet he’s still being deported, an un-named State Department spokes-dweeb says. Still, for everyone’s safety and security, his Hanes-branded guava-themed socks have been burned. Coca Cola denies any complicity. *His calluses were found to be asymptomatic.”

      Yeah, some refreshing, frank, and tasty news!

      I’m just wondering…also just kidding!

      I’m sorry for your injury, but, instead of Florida or South Dakota, I’d suggest a relocation to the ‘free-er’ area(s) of Montana, Idaho, or Wyoming, but good quality healthcare in this region is minimal, or to be plain, LACKING.

      My (further?) apologies, but a couple little joking haikus:
      ———-
      “Ticklish Subject”

      Who’s ‘footing the bill’?
      We, The People, surely will!
      More Socialist SWILL!
      __________
      “Cushy”

      Feathering their nests.
      Robbing US of ALL OUR best!
      It’s God’s supreme test.

      ° ° ° ° ° ° ° ° ° ° ° ° ° ° ° ° °

      Death to ALL TYRANTS, and afterwards, A Happy New Year!

    • Rzv says:

      Why not using a laser to read your temp? Can you please explain so I can understand. thx

      • Jim S Smith says:

        A LASER, if it is shined in your eyes, even briefly, can BLIND YOU. Some of the folks handling these LASER “touch-less thermometers” don’t know all that.

      • Diana says:

        Pineal gland is there in your forehead.

  9. Jon says:

    The true infection is cognitive dissonance. Not only has it seeped into every aspect of our lives, but IMO it is the fuel that evil needs to take hold. Good men are our only hope now.

    • Opie Poik says:

      We lived a year that wasn’t there
      A year that wasn’t there began again today
      I wish a new year would begin and stay:

      https://www.lewrockwell.com/2021/01/no_author/even-while-it-was-happening-it-wasnt-happening/

      “In his Nobel Prize acceptance speech in 2005, the playwright Harold Pinter had this to say about every atrocity concealed by the Western press: ‘It never happened. Nothing ever happened. Even while it was happening it wasn’t happening. It didn’t matter. It was of no interest.’ And so much never happened this past year!”

      The unfree press-titute corps, putting the dis in cognitive dissonance. Thou shalt not notice, 6079 Smith W., that the chocolate ration hath been increased to thirty grams from forty. Big Brother is taking very good care of you, Winston. Be of good cheer. All is well! Pay no attention to that stink behind the message:

      “To know and not to know, to be conscious of complete truthfulness while telling carefully constructed lies, to hold simultaneously two opinions which cancelled out, knowing them to be contradictory and believing in both of them, to use logic against logic, to repudiate morality while laying claim to it, to believe that democracy was impossible and that the Party was the guardian of democracy, to forget whatever it was necessary to forget, then to draw it back into memory again at the moment when it was needed, and then promptly to forget it again: and above all, to apply the same process to the process itself. That was the ultimate subtlety: consciously to induce unconsciousness, and then, once again, to become unconscious of the act of hypnosis you had just performed. Even to understand the word ‘doublethink’ involved the use of doublethink.”
      ~ “1984” by George Orwell (1948)

      Nothing changes, New Year’s Day . . .

      • Jim S Smith says:

        Oh boy!

        I think you just used a whole bunch of “UN-words”.

        You’re not working for Goldstein are you?

        XO XO

  10. From Elsewhere says:

    Swiss doctor treated 2,000 people of what is labeled as COVID-19. All cured. The doctor said this is not right, there is no pandemic, but he does not have enough exposure to the public ear. Or, to those who could do something about it, if they wanted..

    • Lyn P says:

      Perhaps this doctor was one of the 30+ who recorded something for the excellent compilation video warning against the “vaccine?”

      Go to bitchute, add the below at end of url
      video/1ikPCXS5Nn0a/

  11. Aron says:

    See YT or Bitchute for full interview

    Cath_erine Aus_tin Fi_tts, Pl_anet Loc_kdown

    (algorithms preventing me from displaying direct link)

  12. Matt R. says:

    I had to take a COVID spit test for my employer. I’m negative, but I know this process is only the start.

  13. Mos Craciun says:

    Not only WHO is criminal — Santa Claus too…

    Read here about the massacre ( mass murder) committed by Santa at a care home in Belgium : 26 deaths !

    http://www.theguardian.com/world/2020/dec/31/covid-outbreak-hits-belgian-care-home-after-santa-visit

    • Madness says:

      I don’t believe this story. They very likely only used the visit to get rid off more elderly.
      Watch what they are capable of to kill them, a lawyer’ statement from the UK. Youtube removed it.

      bitchute (dot)com/video/87Nmf17f43gr/

      • Mos Craciun says:

        @Madness
        Well, I hope you sensed the sarcasm in my statement. Of course , is exactly as you put it . And yet , “Guardian” is considered kind of NYT in Great Britain. And so , you can see the level of ridicule in their reporting .However , many people take their text face value.
        Yes, they killed the 26 and used the “covid&Santa” as pretext .Is happening everywhere in Europe , not only in USA, as described in the video you posted.

  14. Wayne says:

    Brilliant summation. I’m glad you keep pounding at the PCR test – the biggest scam to ever hit this country, and that’s saying a lot!

  15. Meanwhile the begin to kill all cattle because the PCR test says it is positiv. Mega food crisis next.

    Pigs Catch COVID – UK Bans Free Range Chickens! – War on Meat / Animal Ag – https://www.youtube.com/watch?v=sue5sTGIFZ8

    • Rick Potvin in Phoenix AZ says:

      Darn, and I was just starting to get used to my round steaks on sale too! I cook them really nicely and quickly in my countertop infrared Nuwave cooker. You know– they used that method for drying car paint until around 1995 when the patent expired for drying car paint. Then they started putting them in BBcues… which they promote as easy-to-use but really they’re fake BBcues because they’re using that infrared paint dryer. MMMM… steaks out of a paint drying machine are VERY nice… and don’t lose moisture. All true! Really.

      I only buy free range eggs so the idea that they’re going to pin the phony covid on my steaks and eggs really ticks me off. I’m going to go after them all. I’ll expose them and take them down because “we the people” know better…

      The New World Order psychopaths trying to take us down with their stupid trick virus don’t realize they’re not dealing with Christian Russians in the early 1900’s or Mao’s unarmed academics in the 1960’s. We the people have a tradition of freedom and truth… and the American Way. We grew up reading Superman comic books and watching Batman movies. We the People are going to become our own SuperHeroes. We can wear capes and defend ourSELVES! Those morons better watch out for ME because I have a computer keyboard… and I read Jon Rappaport… I eat steak and eggs… and by God– I intend to keep on doing so. Watch out.

    • Madness says:

      That will be their next step. Food shortage. Meat especially. Schwab that evil also mentioned “cyber attacks” against power plants.

      Klaus Schwab:
      “We all know, but still pay insufficient attention, to the frightening scenario of a comprehensive cyber attack could bring a complete halt to the power supply, transportation, hospital services, our society as a whole. The COVID-19 crisis would be seen in this respect as a small disturbance in comparison to a major cyberattack.

      To use the COVID19 crisis as a timely opportunity to reflect on the lessons the cybersecurity community can draw and improve our unpreparedness for a potential cyber-pandemic.”

      • Jim S Smith says:

        The (on-going) food shortage was already well under way back in about March 2020: When American farmers were being told to destroy their produce, and euthanize their livestock.

        Problem is,

        American farmers were already being squashed out of existence over the years, to make the US dependent on imported food.

    • Mos Craciun says:

      @Corona Coronata

      Did you notice that the “PCR tests” done for this research were at 40 cycles ? No wonder then…..

      • Diana says:

        They will lower the cycles run once enough people get the vaxxine so they can declare their fake victory over their fake virus and congratulate each other.

    • Larry C says:

      My hunch is that the ramping up of the Grimm COVID Fairy Tale in the United Kingdom recently, is payback for its citizens having the gall, the chutzpah, and the utter temerity to demonstrate in the Tens of Thousands, against the lockdowns.

      Oh yeah… and payback for BREXIT.

  16. No More Lies says:

    This from WHO .INT:
    Manufacturers regularly review the design of their product, including labelling and IFU based on customer feedback. In the early phases of the COVID-19 pandemic, in vitro diagnostics (IVDs) were rapidly developed, validated and verified, and then rolled out. Therefore, it is not unexpected that IVDs may require refinement based on user feedback after their introduction at scale. Users should verify the version of the IFU with each consignment they receive to see if any changes have been made to the IFU.

    “ In the early phases of the COVID-19 pandemic, in vitro diagnostics (IVDs) were rapidly developed, validated and verified, and then rolled out. Therefore, it is not unexpected that IVDs may require refinement based on user feedback after their introduction at scale”.
    Doesn’t this basically say” we hauled ass to call this a virus, create a pandemic and make up a test to verify it. Therefore, this test really hasn’t been proven so, keep fooling with it while we figure out the next lie and lockdown”?
    Just wondering.

  17. Larry C says:

    “Users of RT-PCR reagents should read the IFU [Information for Use] carefully to determine if manual adjustment of the PCR positivity threshold is necessary to account for any background noise which may lead to a specimen with a high cycle threshold (Ct) value result being interpreted as a positive result.”

    ‘Translation: Using too many test cycles—aka “high cycle threshold (Ct) value”—has resulted in patients being told they’re infected, which is a lie.’

    I have to assume that a heartfelt, “Gosh, we’re sorry”, from the WHO, for the unbearable emotional strain caused by their complete lapse of scientific/professional standards…in addition to complimentary Dinner for Two coupons to a nice neighborhood restaurant (i.e., if one can be found that is still in business), would suffice by way of compensation for this horrific gaffe.

    BUT THEY’D HAVE TO BE REALLY, REALLY SORRY…AND NO TAKE-BACKS!

  18. Roger welsh says:

    WHO= Bill Gates! The psychopathic schemer owned by the Devil!

  19. Paul says:

    “You Can’t Handle The Truth!”

    ~ Lt. Daniel Kaffe
    (Jack Nicholson)
    A Few Good Men

    O’Hare Airport UFO Sighting

    November 7, 2006 @ 4:15 PM

    (UA GATE C-17)

    Dozens of witnesses. Multiple photos, by multiple witnesses @ different angles.

    Jon Hilkevitch, Chicago Tribune Travel Journalist, witnessed & spoke on npr about it.

    United Airlines prohibited employees to speak to Press.

    Credible witnesses (pilots, airport tower & ground workers) saw large, thin, disc-like craft. On voice transcript of groud–tower conversation.

    “Donut/Punch hole” in clouds created by craft with rapid ascent into/through low cloud cover.

    Heavy-handed Official FAA & UA censorship & debunking–.

    –Standard Procedure 101.

    Oh, well.

    “Truth is stranger than fiction,
    but it is because
    Fiction is obliged
    to stick to possibilities;
    Truth isn’t.”

    ~ Mark Twain

    Happy New Year!

  20. Elijah Varga says:

    The WHO is part of the UN which is the most deceptive Global establishment ever in human history. Peace and security? Just wait, until it fully manifesting itself – but by then it’ll be too late.

  21. No More Lies says:

    MILWAUKEE PHARMACIST GETS ARRESTED FOR DESTROYING 550 DOSES OF “THE” vaks “.
    He j

  22. No More Lies says:

    HE JUST SPARED 550 lives. I’ll be he’s gonna get a lot of Thank You emails 🙂

  23. Darrell says:

    The Luciferian Cabal is now coming out with the goy (that’s debatable, though) front man Bill Gates-predicted “Son of Covid,” the ominous super-fearful mutant killer that Gates told us in 2019 was coming (with a big grin on his face, as with his 2015 prediction of Covid-19). As girly Bill put it: “The next one will get attention this time.” So do your part and above all, BE AFRAID!! And obey those in authority who only have your best interests in mind — just like the demons in hell do.
    http://www.realhistorychan.com/anyt-12312020—son-of-covid-reaches-usa.html

  24. Tom M Culhane says:

    I found a recent video on Bitchute of Dr Tom Cowan saying the best article written on the Corona Hoax is: “Covid19-Evidence of Global Fraud”, found at off-guardian dot org.

    The article of course brings up the fact that no scientific evidence exist for the alleged SARS-CoV-2 virus. But it also states:

    “Something else which is publicly available is the Basic Alignment Search Tool(BLAST). This allows anyone to compare published nucleotide sequences with all those stored by the U.S. National Institutes of Health (NIH) genetic database called GenBank. Therefore we can BLAST the claimed SARS-CoV-2 primers, probes and target gene sequences.

    The WHO’s forward, reverse primers and probe protocols, for the alleged SARS-CoV-2 viral genome, are based upon RdRp, Orf1, N and E gene profiles. Anyone can run them through BLAST to see what we find.

    The vital RdRP nucleotide sequence, used as a forward primer is – ATGAGCTTAGTCCTGTTG. If we run a nucleotide BLAST this is recorded as a complete SARS-CoV-2 isolate with a 100% matched sequence identity. Similarly the reverse E gene primer sequence – ATATTGCAGCAGTACGCACACA – reveals the presence of the Orf1ab sequence which also identifies SARS-CoV-2.

    However, BLAST also enables us to search the nucleotide sequences of the microbial and human genomes. If we search for the RdRp SARS-CoV-2 sequence it reveals 99 human chromosome with a 100% sequence identity match. The Orf1ab (E gene) returns 90 with a 100% sequence identity match to human chromosomes.

    Doing the same for these sequences with a microbial search finds 92 microbes with a 100% match to the SARS-CoV-2 E gene and 100 matched microbes, with a 100% sequence identity, to the vital SARS-CoV-2 RdRp gene.

    Whenever we check the so-called unique genetic markers for SARS-CoV-2, recorded in the WHO protocols, we find complete or high percentage matches with various fragments of the human genome. This suggests that the genetic sequences, which are supposed to identify SARS-CoV-2, are not unique. They could be anything from microbial sequences to fragments of human chromosomes.”

    So it sounds to me like the PCR tests are basically testing to find if you have any human or microbial genetic material in your body. Happy Holidays

    • Tom M Culhane says:

      I closed with ” Happy Holidays” instead of “Happy New Year” for a reason. Would a new cycle really begin in early Winter when Nature is going to sleep, January 1?

      The real New Year of the Ancients began on the first day of Spring, the Equinox, when Day and Night balance out, a gateway time. Your funny calendar calls that day March 21 or so, but it should be called March 1. This makes Spring: March April and May. June 1 then starts Summer, the longest day. Summer is June July and August.

      Sept 1, the Equinox, starts Autumn. This makes September the 7th month of the Year, not the 9th as found on your funny calendar. The Latin word for 7 is Septem. October goes with the 8th month, as in Octagon. November is the 9th month, Movem is Nine in Latin. December 1 then starts Winter, the Yule, the longest night. December then is the 10th month, as in decimal, decade, etc. January is the 11th month and February the 12th month of the Year. That’s the real reason if it is a leap year you’d put the extra day at the end of February, before beginning the next Year on March 1.

      Hope that’s clear. The bad guys are smarter than people think. They mess with our rhythms, trying to get us out of synch with Nature. That’s why the Clock is off an hour most of the year now, so midday isn’t really high Noon and midnight isn’t really the middle of the night. There’s a lot more too. Happy New Year in advance.

  25. Grant says:

    Guys we are in the Great Reset and what I have read just mind blowing. We have been lied too for decades and there is treason to the full extent of the law. America needs to follow the Amendments or will be lost forever. Here a few websites that came across that explains alot and has evaded censorship.

    https://beforeitsnews.com/christian-news/2020/12/c-bs-its-all-a-lie-and-people-need-to-wake-up-or-perish-the-first-second-wave-covid-hoax-the-gates-of-hell-jab-will-only-enslave-you-mame-you-possibly-kill-you-the-jab-is-2591720.html

    https://johnscottconsciousness.com/germ-theory/

    https://hnewswire.com/covid-19-was-planned-to-usher-in-the-new-world-order-if-biden/

    There is a ton of information here some may already know and a lot will be new to you as was for me.

    By the way Happy New Year

  26. Pierre says:

    Hi everybody ,
    don’t despair ! This year will be a liberation .

    Bonne année de Bordeaux ,
    Pierre

  27. John Thuloe says:

    The medical racketeers might move to wind down PCR testing or better, ratchet down the cycles and still get paid for tons of ‘testing’. Better to swing into making boodles off the virus. However, any decrease in positive tests undermines the campaigns to drive people into accepting the virus. Once this pressure lets up people will be more resistant to lockdowns. The longer the lockdowns go on the more business interests will turn against them for their own reasons. So, ever more repressive measure must be continually applied to keep the population locked down. Thus, engendering those forces which will resist. With force. Plus, given any breathing space, matters will get traction in courts and the public display of hard evidence is not favourable to the pandemic pushers.

    Hoisted on their own petard they all are. Serves them right.

  28. Kate B says:

    EMAIL EXCHANGE WITH UK MHRA – Exposing the genomic sequence of SARSCov2
    https://hive.blog/worldnews/@francesleader/email-exchange-with-uk-mhra-exposing-the-genomic-sequence-of-sarscov2

    WITHOUT A PURIFIED SAMPLE VIRUS UK MHRA CONFESSES THAT THE PFIZER VACCINE mRNA ELEMENT IS A COMPUTER GENERATED GENOMIC SEQUENCE AMPLIFIED FROM A RNA FRAGMENT FOUND IN ONE EXPERIMENTAL STUDY FROM WUHAN (Feb 2020).
    NO SIMILAR VIRUS HAS BEEN ISOLATED ANYWHERE IN THE WORLD SINCE.
    THE VACCINES ARE CREATED USING A COMPUTER MODEL!

  29. TCM says:

    “The PCR products have not been validated at the molecular level. This fact makes the protocol useless as a specific diagnostic tool to identify the SARS-CoV-2 virus…The PCR test contains neither a unique positive control to evaluate its specificity for SARS-CoV-2 nor a negative control to exclude the presence of other Coronaviruses, making the test unsuitable as a specific diagnostic tool to identify the SARS-CoV-2 virus.”

    There you have it from a “External peer review of the RTPCR test to detect SARS-CoV-2 reveals 10 major scientific flaws at the molecular and methodological level: consequences for false positive results.”

    The PCR Test’s whole purpose wasn’t to diagnose ConVid, it was to drive the Casedemic to justify the totalitarian wet dreams of Politicians worldwide.

  30. el Gallinazo says:

    “The WHO document is titled, “WHO Information Notice for IVD Users/Nucleic acid testing (NAT) technologies that use real-time polymerase chain reaction (RT-PCR) for detection of SARS-CoV-2.” [2]”

    As a chemist, I found it interesting that the WHO should refer to the RT in RT-PCR as “real time” which is quite meaningless, while in truth it refers to reverse transcriptase. Are they that ignorant or is there a reason they wish to obscure this? PCR only works with DNA, so to use it on RNA genetic material, the sample has to be treated with an enzyme which converts the RNA to a DNA analog. This reverse transcriptase is extracted from RNA retroviruses of which HIV is amusingly a member.

    • Pam says:

      That’s really interesting! I was reading a PCR test report my son had to get to fly. They specifically wrote: “The SARS-CoV-2 (COVID-19) RT-PCR test is a real-time RT-PCR test intended for the qualitative detection of SARS-CoV-2 specific nucleic acid from upper respiratory tract specimens.” What are they up to?

  31. Arby says:

    “viral load”? Scary stuff that. ‘We noticed that you’re human. We have to do something about it’. Those viruses are exosomes. They aren’t attacking us. They ‘are’ us.

  32. B_K says:

    I appreciate all your work. I have been reading your articles since March 2020. Your work has opened my eyes. I view everything differently now. Nowadays, I deal with children and adolescents more than adults with anxiety, panic attacks, depression to name a few of those problems that come under the canopy of mental health. I am doing the difficult job of educating patients and helping them in informed decision making regarding meds/ biologics/ tests, a tough job, but I will do it because it is the right thing to do. My heartfelt thanks to you again. May God bless you!

Comments are closed.